Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 64260
End position: 64304
Length: 45

DNA sequence
>NC_017365, from 64260 to 64304 (45 bp); Helicobacter pylori F30 TTCTTCTTTAGGCTCTTCTTTTTTAACCTCTTCAACTTTAGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 63826-64683	Sequence	HPF30_0059 tonB siderophore-mediated iron transport protein (Protein is coded in complementary strand; from 64683 to 63826)