Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 750249
End position: 750284
Length: 36

DNA sequence
>NC_017365, from 750249 to 750284 (36 bp); Helicobacter pylori F30 AAAGCGCGCAAAAAATCGCACAAAAAATCGCGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 749544-751853	Sequence	HPF30_0705 mutS recombination and DNA strand exchange inhibitor protein