Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 77054
End position: 77080
Length: 27

DNA sequence
>NC_017365, from 77054 to 77080 (27 bp); Helicobacter pylori F30 TTTAGTTTCTTTAGTTTCTTTGGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 76137-77153	Sequence	HPF30_0072 czcB cation efflux system protein (Protein is coded in complementary strand; from 77153 to 76137)