Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 972010
End position: 972033
Length: 24

DNA sequence
>NC_017365, from 972010 to 972033 (24 bp); Helicobacter pylori F30 TTTTCAGTTTCATTTTCTGTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 969856-972708	Sequence	HPF30_0898 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 972708 to 969856)