Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 1130753
End position: 1130779
Length: 27

DNA sequence
>NC_017367, from 1130753 to 1130779 (27 bp); Helicobacter pylori F57 TTTTCTAAATTTTCTAAGGTTTCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1130657-1132483	Sequence	HPF57_1062 edd phosphogluconate dehydratase (Protein is coded in complementary strand; from 1132483 to 1130657)