Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 1167703
End position: 1167732
Length: 30

DNA sequence
>NC_017367, from 1167703 to 1167732 (30 bp); Helicobacter pylori F57 CCAGAAAATACCACAAAATCCCCGCAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1167330-1167845	Sequence	HPF57_1099 atpF F0F1 ATP synthase subunit B (Protein is coded in complementary strand; from 1167845 to 1167330)