Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 1196748
End position: 1196772
Length: 25

DNA sequence
>NC_017367, from 1196748 to 1196772 (25 bp); Helicobacter pylori F57 AAAGAAAATAAAAGGATAGAAATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1196557-1196748	Sequence	HPF57_1125 fixS cation transport subunit for cbb3-type oxidase
ORF... 1196770-1197738	Sequence	HPF57_1126 trxB_2 thioredoxin reductase