Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 1296140
End position: 1296175
Length: 36

DNA sequence
>NC_017367, from 1296140 to 1296175 (36 bp); Helicobacter pylori F57 TCTTGTTTAGTTTCTTGTTTATTTTCTTGTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1295855-1296457	Sequence	HPF57_1209 - hypothetical protein (Protein is coded in complementary strand; from 1296457 to 1295855)