Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 1422331
End position: 1422357
Length: 27

DNA sequence
>NC_017367, from 1422331 to 1422357 (27 bp); Helicobacter pylori F57 TGTTTTCATTATTTTCATTGTTTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1420293-1422377	Sequence	HPF57_1342 - ATP-binding protein (Protein is coded in complementary strand; from 1422377 to 1420293)