Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 149346
End position: 149369
Length: 24

DNA sequence
>NC_017367, from 149346 to 149369 (24 bp); Helicobacter pylori F57 TAAGTTTAAGATTAACTTTAAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 148949-149944	Sequence	HPF57_0144 - HrgA protein (Protein is coded in complementary strand; from 149944 to 148949)