Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 192126
End position: 192161
Length: 36

DNA sequence
>NC_017367, from 192126 to 192161 (36 bp); Helicobacter pylori F57 CCTCTTTAGGCTCCTCTTTAGTTTCTTCTTTAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 191507-192226	Sequence	HPF57_0188 - hypothetical protein (Protein is coded in complementary strand; from 192226 to 191507)