Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 499225
End position: 499260
Length: 36

DNA sequence
>NC_017367, from 499225 to 499260 (36 bp); Helicobacter pylori F57 GAAGCGTTTGTGGAGGCGTTCGTGGAGGCGCTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 498965-502096	Sequence	HPF57_0491 - Type I restriction enzyme R protein (Protein is coded in complementary strand; from 502096 to 498965)