Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 572666
End position: 572695
Length: 30

DNA sequence
>NC_017367, from 572666 to 572695 (30 bp); Helicobacter pylori F57 GCTTTTTTTAGCTTCTTCTAACTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 569178-574571	Sequence	HPF57_0557 cagY cag pathogenicity island protein Y VirB10-like protein (Protein is coded in complementary strand; from 574571 to 569178)