Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 6691
End position: 6717
Length: 27

DNA sequence
>NC_017367, from 6691 to 6717 (27 bp); Helicobacter pylori F57 CTACTACCACTATTACCACTACTACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5248-7401	Sequence	HPF57_0007 hopZ outer membrane protein (Protein is coded in complementary strand; from 7401 to 5248)