Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 679288
End position: 679323
Length: 36

DNA sequence
>NC_017367, from 679288 to 679323 (36 bp); Helicobacter pylori F57 ATTTGCGCGATTTTTTGCGCGATTTTTTGCGCGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 677722-679971	Sequence	HPF57_0646 mutS recombination and DNA strand exchange inhibitor protein (Protein is coded in complementary strand; from 679971 to 677722)