Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 7716
End position: 7751
Length: 36

DNA sequence
>NC_017367, from 7716 to 7751 (36 bp); Helicobacter pylori F57 CATGCCGCCCATGCCTCCCATACCGCCCATGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7711-9351	Sequence	HPF57_0008 groEL chaperonin GroEL (Protein is coded in complementary strand; from 9351 to 7711)