Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 832806
End position: 832829
Length: 24

DNA sequence
>NC_017367, from 832806 to 832829 (24 bp); Helicobacter pylori F57 AACAAAAACAACAAAAAAAACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 832140-832877	Sequence	HPF57_0793 - hypothetical protein (Protein is coded in complementary strand; from 832877 to 832140)