Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 855134
End position: 855181
Length: 48

DNA sequence
>NC_017367, from 855134 to 855181 (48 bp); Helicobacter pylori F57 TTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 854420-855712	Sequence	HPF57_0810 hsdS_2 type I restriction-modification system specificity subunit (Protein is coded in complementary strand; from 855712 to 854420)