Sequence retrieval

Genome: Helicobacter pylori F57
Start position: 910244
End position: 910279
Length: 36

DNA sequence
>NC_017367, from 910244 to 910279 (36 bp); Helicobacter pylori F57 TTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 909569-910759	Sequence	HPF57_0869 hsdS-2 type I restriction-modification system specificity subunit (Protein is coded in complementary strand; from 910759 to 909569)