Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 1152127
End position: 1152156
Length: 30

DNA sequence
>NC_017375, from 1152127 to 1152156 (30 bp); Helicobacter pylori 83 CCAGAAAATACCACAAAATCCCCGCAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1151754-1152269	Sequence	HMPREF0462_1147 - ATP synthase subunit B (Protein is coded in complementary strand; from 1152269 to 1151754)