Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 1179891
End position: 1179920
Length: 30

DNA sequence
>NC_017375, from 1179891 to 1179920 (30 bp); Helicobacter pylori 83 ATCATCATCGTCATCATCGTCATCATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1179877-1180359	Sequence	HMPREF0462_1172 - hypothetical protein (Protein is coded in complementary strand; from 1180359 to 1179877)