Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 132113
End position: 132157
Length: 45

DNA sequence
>NC_017375, from 132113 to 132157 (45 bp); Helicobacter pylori 83 GCTTTAATTTCTTTGACTTTGCTTTCTTTGGTTTTAGTTTCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 130247-132271	Sequence	HMPREF0462_0141 rpoD DNA-directed RNA polymerase sigma subunit RpoD (Protein is coded in complementary strand; from 132271 to 130247)