Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 1406794
End position: 1406829
Length: 36

DNA sequence
>NC_017375, from 1406794 to 1406829 (36 bp); Helicobacter pylori 83 TGTTTTCATTGTTTTCATTGTTTTCATTGTTTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1404756-1406867	Sequence	HMPREF0462_1407 - ribonuclease J (Protein is coded in complementary strand; from 1406867 to 1404756)