Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 212189
End position: 212224
Length: 36

DNA sequence
>NC_017375, from 212189 to 212224 (36 bp); Helicobacter pylori 83 CCTCTTTAGGCTCCTCTTTAGTTTCTTCTTTAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 211570-212289	Sequence	HMPREF0462_0222 - hypothetical protein (Protein is coded in complementary strand; from 212289 to 211570)