Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 485036
End position: 485071
Length: 36

DNA sequence
>NC_017375, from 485036 to 485071 (36 bp); Helicobacter pylori 83 GAAGCGTTTGTGGAGGCGTTCGTGGAGGCGTTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 484779-486173	Sequence	HMPREF0462_0500 hsdR type I restriction enzyme R protein (Protein is coded in complementary strand; from 486173 to 484779)