Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 759729
End position: 759758
Length: 30

DNA sequence
>NC_017375, from 759729 to 759758 (30 bp); Helicobacter pylori 83 CAAAGCGCTTCAAACCACTTAAAAGCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 759570-760244	Sequence	HMPREF0462_0778 - quinone-reactive Ni/Fe hydrogenase HydC (Protein is coded in complementary strand; from 760244 to 759570)