Sequence retrieval

Genome: Helicobacter pylori 83
Start position: 904501
End position: 904530
Length: 30

DNA sequence
>NC_017375, from 904501 to 904530 (30 bp); Helicobacter pylori 83 CCTTTTAAACATTTTTAAACTTTTTTAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 903188-904513	Sequence	HMPREF0462_0914 - plasminogen-binding protein PgbA (Protein is coded in complementary strand; from 904513 to 903188)
ORF... 904516-905154	Sequence	HMPREF0462_0915 nudT14 UDP-sugar diphosphatase (Protein is coded in complementary strand; from 905154 to 904516)