Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 1776808
End position: 1776831
Length: 24

DNA sequence
>NC_017452, from 1776808 to 1776831 (24 bp); Haemophilus influenzae R2846 GCTGCTGCTACTGCTGCCGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1776562-1776933	Sequence	R2846_1699 rpL7 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1776933 to 1776562)