Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 357569
End position: 357595
Length: 27

DNA sequence
>NC_017452, from 357569 to 357595 (27 bp); Haemophilus influenzae R2846 AGCACGACCAGAACGACCAGCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 356760-358601	Sequence	R2846_0369 deaD ATP-dependent RNA helicase DeaD (Protein is coded in complementary strand; from 358601 to 356760)