Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 1495909
End position: 1495938
Length: 30

DNA sequence
>NC_017452, from 1495909 to 1495938 (30 bp); Haemophilus influenzae R2846 TATTCTTTTTCTTATTTTTTTTCTTATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1495206-1495976	Sequence	R2846_1420 ftsN hypothetical protein (Protein is coded in complementary strand; from 1495976 to 1495206)