Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 788676
End position: 788705
Length: 30

DNA sequence
>NC_017452, from 788676 to 788705 (30 bp); Haemophilus influenzae R2846 GCTGATGCTGAATCTGATGCTGATGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 787635-789266	Sequence	R2846_0759 aceF Dihydrolipoamide acetyltransferase (Protein is coded in complementary strand; from 789266 to 787635)