Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 37231
End position: 37266
Length: 36

DNA sequence
>NC_017452, from 37231 to 37266 (36 bp); Haemophilus influenzae R2846 CATTCCGCCCATTCCACCCATTCCACCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 37226-38881	Sequence	R2846_0042 groEL GroEL, chaperone Hsp60 (Protein is coded in complementary strand; from 38881 to 37226)