Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 420582
End position: 420617
Length: 36

DNA sequence
>NC_017452, from 420582 to 420617 (36 bp); Haemophilus influenzae R2846 TAAGCTCGCTGGTAAGCTCGCTGGTAAGCTCGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 419915-421105	Sequence	R2846_0422 hsdS1 DNA specificity protein of restriction modification system (Protein is coded in complementary strand; from 421105 to 419915)