Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 515834
End position: 515887
Length: 54

DNA sequence
>NC_017452, from 515834 to 515887 (54 bp); Haemophilus influenzae R2846 ATGCTCGTGTTTATGATCGTGGTCGTGTTTATGGTCATGGTCATGTTTATGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 515274-516293	Sequence	R2846_0517 znuA Periplasmic zinc-binding protein (Protein is coded in complementary strand; from 516293 to 515274)