Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 1505816
End position: 1505875
Length: 60

DNA sequence
>NC_017452, from 1505816 to 1505875 (60 bp); Haemophilus influenzae R2846 ACGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1504995-1505879	Sequence	R2846_1428 - glycosyltransferase (Protein is coded in complementary strand; from 1505879 to 1504995)