Sequence retrieval

Genome: Haemophilus influenzae R2846
Start position: 581129
End position: 581191
Length: 63

DNA sequence
>NC_017452, from 581129 to 581191 (63 bp); Haemophilus influenzae R2846 AAATATTGGTGTAACTCTGTAGGATATTGGTGTAACTCTGTAGGATATTGGTGTAACTCTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 580100-583087	Sequence	R2846_0577 glnE Glutamate-ammonia-ligase adenylyltransferase (ATase) (Protein is coded in complementary strand; from 583087 to 580100)