Sequence retrieval

Genome: Lactococcus lactis subsp. cremoris A76
Start position: 1061979
End position: 1062032
Length: 54

DNA sequence
>NC_017492, from 1061979 to 1062032 (54 bp); Lactococcus lactis subsp. cremoris A76 GGTGTAGGATCTGGGTCTGGTGTAGGATCTGGGTCTGGTGTAGGATCTGGGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1061727-1062257	Sequence	llh_5700 - hypothetical protein (Protein is coded in complementary strand; from 1062257 to 1061727)