Sequence retrieval

Genome: Lactococcus lactis subsp. cremoris A76
Start position: 1096497
End position: 1096520
Length: 24

DNA sequence
>NC_017492, from 1096497 to 1096520 (24 bp); Lactococcus lactis subsp. cremoris A76 CAAAATCAAAAACTAAATCAACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1096208-1096573	Sequence	llh_5885 - hypothetical protein (Protein is coded in complementary strand; from 1096573 to 1096208)