Sequence retrieval

Genome: Lactococcus lactis subsp. cremoris A76
Start position: 1177599
End position: 1177652
Length: 54

DNA sequence
>NC_017492, from 1177599 to 1177652 (54 bp); Lactococcus lactis subsp. cremoris A76 CCAGTTGAACCTGTATCTCCAGTAGATCCAGTATCTCCCGTTGAACCTGTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1177116-1178546	Sequence	llh_6340 - flagellar hook-length control protein FliK (Protein is coded in complementary strand; from 1178546 to 1177116)