Sequence retrieval

Genome: Lactococcus lactis subsp. cremoris A76
Start position: 1430773
End position: 1430796
Length: 24

DNA sequence
>NC_017492, from 1430773 to 1430796 (24 bp); Lactococcus lactis subsp. cremoris A76 CTTATTATTATTCTTCTTCTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1430771-1431412	Sequence	llh_7675 - Acyl-phosphate:glycerol-3-phosphate O-acyltransferase PlsY