Sequence retrieval

Genome: Lactococcus lactis subsp. cremoris A76
Start position: 1831671
End position: 1831700
Length: 30

DNA sequence
>NC_017492, from 1831671 to 1831700 (30 bp); Lactococcus lactis subsp. cremoris A76 TTTTTTCTTTTTCTTATTTTTGTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1830547-1832187	Sequence	llh_9810 - hypothetical protein (Protein is coded in complementary strand; from 1832187 to 1830547)