Sequence retrieval

Genome: Lactococcus lactis subsp. cremoris A76
Start position: 2002181
End position: 2002216
Length: 36

DNA sequence
>NC_017492, from 2002181 to 2002216 (36 bp); Lactococcus lactis subsp. cremoris A76 TTATTATTTGATTTATTAATTGATTTATTAGTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2001779-2002585	Sequence	llh_10815 - putative replication protein (Protein is coded in complementary strand; from 2002585 to 2001779)