Sequence retrieval

Genome: Lactococcus lactis subsp. cremoris A76
Start position: 740667
End position: 740691
Length: 25

DNA sequence
>NC_017492, from 740667 to 740691 (25 bp); Lactococcus lactis subsp. cremoris A76 TTTTTTTTATTTTTTTTTCTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 740674-741057	Sequence	llh_3945 - Putative regulator of the mannose operon, ManO (Protein is coded in complementary strand; from 741057 to 740674)