Sequence retrieval

Genome: Paenibacillus polymyxa M1
Start position: 1410938
End position: 1410964
Length: 27

DNA sequence
>NC_017542, from 1410938 to 1410964 (27 bp); Paenibacillus polymyxa M1 CATGGGCGGCATGGGCGGAATGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1409347-1410975	Sequence	PPM_1159 groEL 60 kDa chaperonin Protein Cpn60; groEL protein