Sequence retrieval

Genome: Paenibacillus polymyxa M1
Start position: 2478204
End position: 2478230
Length: 27

DNA sequence
>NC_017542, from 2478204 to 2478230 (27 bp); Paenibacillus polymyxa M1 GTTCAAGGCGTCCAAGGCGATCAAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2477242-2479869	Sequence	PPM_2154 bclA collagen alpha-1(XXVII) chain Flags: Precursor