Sequence retrieval

Genome: Paenibacillus polymyxa M1
Start position: 777725
End position: 777751
Length: 27

DNA sequence
>NC_017542, from 777725 to 777751 (27 bp); Paenibacillus polymyxa M1 CCCGGCAGGCCCAGCAGGCCCAGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 776706-778442	Sequence	PPM_0635 M1-820 collagen alpha-5(VI) chain (Protein is coded in complementary strand; from 778442 to 776706)