Sequence retrieval

Genome: Paenibacillus polymyxa M1
Start position: 3058815
End position: 3058844
Length: 30

DNA sequence
>NC_017542, from 3058815 to 3058844 (30 bp); Paenibacillus polymyxa M1 CAGCAAGAAGCAGCAAGGAACAGCAGCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3057560-3058864	Sequence	PPM_2586 M1_2907 hypothetical protein (Protein is coded in complementary strand; from 3058864 to 3057560)