Sequence retrieval

Genome: Paenibacillus polymyxa M1
Start position: 2991172
End position: 2991207
Length: 36

DNA sequence
>NC_017542, from 2991172 to 2991207 (36 bp); Paenibacillus polymyxa M1 CATAGGTTGCATAGGTTGCATAGGTTGCATAGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2990819-2991301	Sequence	PPM_2528 gerQ spore coat protein gerQ (Protein is coded in complementary strand; from 2991301 to 2990819)