Sequence retrieval

Genome: Paenibacillus polymyxa M1
Start position: 501679
End position: 501732
Length: 54

DNA sequence
>NC_017542, from 501679 to 501732 (54 bp); Paenibacillus polymyxa M1 GGATCGGTAGGCGTACCTGGGTTTGTAGGCGTACCTGGATCAGTAGGTGTACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 501226-504837	Sequence	PPM_0403 M1-568 lpxtg-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 504837 to 501226)