Sequence retrieval

Genome: Staphylococcus pseudintermedius ED99
Start position: 1728537
End position: 1728566
Length: 30

DNA sequence
>NC_017568, from 1728537 to 1728566 (30 bp); Staphylococcus pseudintermedius ED99 TTGCTCGACATTTCTTGACATCGCTCGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1728298-1729308	Sequence	SPSE_1688 - hypothetical protein (Protein is coded in complementary strand; from 1729308 to 1728298)